BIOLOGY

 

If  I open my dictionary, I read the following: « As a life science, biology concerns all aspects of life, from biochemical reactions to life in society. Since the subject is very complex, every aspect of this study has been covered by specific fields of expertise: biochemistry, cytology, histology, physiology, genetics, etc., each of which has its own goals, methods and techniques. At present, under the heading of biology (general), only fundamental vital phenomena are considered, such as chemical constitution, structures and physiology of cells as well as the organisation and general functions of living beings ». In brief, and seen from this angle, the approach to living organisms taken by biology today is based essentially on two observations:

 

1.  A living organism burns, releasing carbon dioxide, water vapour, mineral salts (ashes) and energy. It can therefore be considered to be the visible result of a multitude of chemical reactions, based on carbon chemistry. When we take this approach, we do « molecular biology »…

-

2.  A living organism is composed of cells. Even better: from the start it consists of one cell, which, through successive division, gives rise to a multitude of other cells which all have the same nucleus… Two cases can be envisaged here: After each cell division:

  • the « daughter cells » split and go their separate ways. This is a single-celled organism.
  • the « daughter cells » remain attached to each other, organise into a more or less complex system which is the only one capable of guaranteeing perpetuation of the species. This is a multicellular- organism. The approach which gives priority to this aspect is called- « cell biology ».

THE CONCEPT OF CHEMICAL REACTION

 

According to the dictionary, « a chemical reaction is the transformation of one chemical species into another. It is characterised by an exchange of molecules, atoms, ions or electrons; the bonds between the atoms of molecules being formed must be more stable than those of the initial molecules ».

« Some of these reactions do not require any initial external contribution of energy. They occur spontaneously both inside and outside the living organism. Non-specific and reversible, they lead to a balanced state which varies according to temperature and pressure ».  e.g.:

 

acid + base ====== salt + water

 

 

« Other chemical reactions require an additional external supply of energy and therefore require the intervention of specific catalysts. They are neither spontaneous nor reversible (at least not naturally). In the living organism, they are catalysed by enzymes, large molecules which are synthesised by cells and the activity subjected to environmental influence. Known as « enzymatic reactions », these are highly specific and are involved either in a process of synthesis (1) or breakdown » (2).  e.g.:

 

 1. 6 CO2 + 6 H2O + energy —- C6H12O6 + 6 O2
2. C6H12O6 + 6 O2 —- 6 CO2 + 6 H2O + energy

 

 

N.B. In the approach to biology taken here (Grandpa’s biology), the first type of reactions will be considered to be regulatory reactions, which seems quite logical because, in the world around us, a system which is not in balance has no other choice but to restore this balance or throw in the towel.

 

THE CONCEPT OF A CELL

 

We are accustomed to comparing a cell with a tiny chemical factory, the floor, walls and roof of which are represented by the cell walls…, walls whose permeability acts as doors, windows, chimneys and other waste disposal channels.

 

This factory is fully computerised. Its activity is governed by a sort of computer called the nucleus. In this nucleus there is a series of diskettes which are usually in pairs: the chromosomes.These chromosomes hold more or less large quantities of encoded information, the genes; the code used is therefore called the « genetic code ». These genes, which vary in number from a few hundred in the simplest organisms to several tens of thousands in the most complex organisms, therefore represent the organism’s genetic programme:

 

  • A programme which is transmitted from one generation to the next and is found in every cell in the organism (genes double in number each time a cell divides);
  • A programme which, outside periods of cell division, conditions- everything that happens in the cell including enzyme synthesis.

 

Outside periods of cell division, genes are generally inactive. They only become active at certain times, depending on the data provided by the cell (today we consider that certain hormones may play an important part). They therefore act as the nucleus’ random access memory (RAM), which conditions all cell activity in the short term and the entire evolution of the organism in the long term.

 

 

DNA (DEOXYRIBONUCLEIC ACID)

 

We have compared the cell nucleus to a computer with its memory represented by genes. Genes consist of DNA. They vary in number from several hundred in the simplest organisms to 30 or 50 000 in humans. They carry all the information the organism needs to grow from a single cell (the egg) to the embryo, from the embryo to childhood, from childhood to adult status, to old age and death.

This DNA is in the form of long molecules organised in double strands, a bit like flies. These flies are rather special though because they have two types of buttons and button-holes, positioned on either of the strands of the double chain, but always matching: the famous Adenine/Thymine and Guanine/Cytosine groups, known as AT and GC, which are based on the attraction between a positively charged hydrogen ion (H+) and two negatively charged molecules.

Like all self-respecting flies, the double DNA chains are usually closed: the genes are then called inactive or repressed. Like all self-respecting flies, these same double chains open from time to time: the genes are then called active or derepressed. Why? Because on opening, enzymes called RNA-polymerases can synthesise a few molecules of RNA, a substance similar to DNA which we are going to talk about now.

 

 

RNA (RIBONUCLEIC ACIDS)

 

RNA is in the form of long molecules with one strand, replicas of one of the strands of the double DNA chains, from which they are synthesised. These newly synthesised molecules will migrate to the closest structures in the nucleus, the ribosomes, where the genetic information they carry will be decoded and physically transcribed into proteins.

Because its double chain structure is based on the existence of AT and GC groups, the DNA molecule (the cache memory of this nucleus-computer) is binary in nature, which it is difficult to ignore completely if we are to understand its mode of action (see later). The problem with RNA (this computer’s RAM) is different, on the other hand. This is a single-strand molecule, characterised by a sequence of four molecules (A, T, G, C).  e.g.:

 

ADN 117 ATGCCGTATAATGATCGTTTCGATAATG
TACGGCATATTACTAGCAAAGCTATTAC
ARN 117 TACGGCATATTACTAGCAAAGCTATTAC

PROTEINS AND ENZYMES

 

Proteins are large twisted, folded molecules consisting of twenty different amino acids. They have a primary, secondary and tertiary structure which makes them highly specific, from both a chemical and physiological point of view. They are classified in three categories depending on their size, solubility and the part they play in the organism: structural proteins, reserve proteins, active proteins or enzymes. These last ones interest us here.

Relatively small, soluble and mobile, enzymes are sort of organic catalysts. They each initiate a very specific chemical reaction inside the cell. These are enzymatic reactions. They are always part of one of the many synthetic or respiratory processes, which, in the short term, will determine all the body’s activity, and in the longer term, its entire evolution (growth, differentiation, reproduction, senescence, sensitivity or resistance to one disease or another). This is shown in the well-known diagram:

 

DNA —— RNA —– ENZYMES —- CHEMICAL REACTIONS

 

 

It only remains to note something obvious here. For one of these synthetic or respiratory reactions to take place, two things are essential:

  • the corresponding enzyme must obviously be present in the cell (in other words, it must have been synthesised by the nucleus);
  • it must also be active.

 

An old philosophical principle states that « we act as we are », and enzymes, because of their convoluted structure, their size (relatively small) and their solubility (relatively high), are extremely sensitive to temperature, light, humidity, pH and obviously the nutrition reigning in the cell. Thus:

  • an enzyme which is part of the cellulase group can only transform saccharose into cellulose if there is saccharose in the cell;
  • it may be active at 25°C, inactive at 18 or 30°C;
  • it may be active during the day and inactive at night, if it has a prosthetic group which is a colour pigment excited by certain wavelengths of light (this does not appear to be the case with cellulases but the principle still applies);
  • it may be active when the body has enough water, and this activity may slow down or stop during dry periods;
  • finally it may be active at pH 6 and inactive at pH 7.

 

All these phenomena which regulate enzyme activity are therefore essentially concerned with balance. We shall see that, in Grandpa’s biology the same applies to events which control enzyme synthesis.

THE CONCEPT OF PLANTS HORMONES

 

If I open my dictionary once more, I can now read: « By analogy, substances produced by plants which are essential to their growth are known as plant hormones ». This analysis of the problem given by our stout dictionary is a bit lightweight and it may be useful to add the following:

 

In the plant kingdom, there are two well known types of hormones: the auxins, produced by nitrogen metabolism, and the gibberellins produced by carbon metabolism. Simple molecules, characterised by an unsaturated cyclic nucleus, and relatively easy to synthesise, they are found commercially in the form of powders which are soluble in alcohol.

 

Auxins and gibberellins have two characteristics in common:

  • they move around the plant and meet in all the plant tissues;
  • they always act everywhere and at all levels, this action varying with the dose used, the age and physiological condition of the plant, environmental conditions and hormones already found in the tissues. ‘Always’ means during growth, differentiation, reproduction, senescence, sensitivity or resistance to this or that disease. ‘Everywhere’ means in the roots, stems, leaves, flowers and fruit. ‘At all levels’ means in basic and intermediate metabolism and in the plant phenotype.

 

The most well-known auxin is indolacetic acid or IAA. The most well-known gibberellin is gibberellic acid or GA. Their structures and synthetic chains lead us to believe that they are close to animal serotonin and steroid hormones respectively.

 

 

THE SUGAR / NITROGEN RATIO

 

Young plants are low in sugars and rich in nitrogen, whereas old plants are poor in nitrogen and rich in sugars. Is this the result of natural selection, since young plants need large amounts of nitrogen for their growth? Are old plants naturally diabetic? I really don’t know. Let’s say it’s like that and leave it at that. What is certain is that this phenomenon conditions most methods of cultivation, in agriculture (in general) and in arboriculture (in particular), with the aim of obtaining the best possible harvest. Given that young trees do not produce fruit and that old trees produce less and less…, it is easy to conclude that trees need to be kept in a state of production, i.e. in a physiological condition which is midway between youth and age. In other words, we must be sure that their tissues are neither too rich nor too poor in sugars and neither too rich nor too poor in nitrogen.

 

When winter comes and the sap is no longer rising so fast, the tree grower takes his secateurs and starts pruning the trees. Does he need firewood? Not really. He does it because, by removing part of the branches, he also removes the leaves which would start growing on these branches in the spring. Leaves are green because they contain chlorophyll, a pigment which captures light energy to fuel sugar synthesis using carbon dioxide from the air which is absorbed at the stomata, and water from the ground absorbed by the roots. This takes place as shown in the well-known equation:

 

6CO2 + 6H2O + light energy —– C6H12O6 + 6O2

 

 

In fact, by pruning the trees more or less severely, the tree grower tries to control the tree’s ability to synthesise sugars, depending on its age, physiological condition and the type of cultivation practised. He won’t prune his trees the same way if he wants trees which go into production rapidly (small trees with a relatively short life) or bigger trees which start production later but live longer…, depending on whether the trees are young or old or whether the soil in which they are planted is more or less rich in nitrogen… etc.

 

Remember that for plants, like all other living organisms, sugars are not only the source of energy they need for physiological activity, but also the basic substances essential for the production of all other organic components (cellulose, lignin, fats, proteins, nucleic acids, etc.)

 

 

And then in spring, he adds fertiliser to the soil. Growth starts again. The roots must now find in the soil all the mineral elements the plants need, particularly nitrogen, an essential complement to sugars for the production of proteins, nucleic acids and other nitrogenous substances. Not too much, but just enough for growth in a young plant and a good harvest once it is adult, or to rejuvenate an ageing tree.

 

 

I have included this paragraph on the importance of the sugar/nitrogen ratio in agriculture because Grandpa used it to study the influence of hormones on plant development.